Stem-loop sequence cre-MIR1168

AccessionMI0006228 (change log)
DescriptionChlamydomonas reinhardtii miR1168 stem-loop
Stem-loop
     -   u  gu  ----u      g  -  -               g     g  c                g                    -u   a 
5' gc ggc ug  cu     uccgcg ug gc cuccuccucaaucuu gccuu cg gcuucgggcuuggccu gucuacacagcaggcagggu  ggg a
   || ||| ||  ||     |||||| || || ||||||||||||||| ||||| || |||||||||||||||| ||||||||||||||||||||  ||| g
3' cg ccg gc  gg     gggcgu ac ug gaggaggaguuagaa cggaa gc cgaagccugaaccgga caggugugucguccguccca  ccc c
     u   u  ug  uaccu      g  g  c               g     g  a                a                    uu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_40: 432487-432679 [-]
intergenic
Database links

Mature sequence cre-miR1168.1

Accession MIMAT0005424
Sequence

114 - 

uguggacaaggccaaguccga

 - 134

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1168.2

Accession MIMAT0005425
Sequence

135 - 

agcacggaaggcgaaga

 - 151

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).