Stem-loop sequence cre-MIR1169

AccessionMI0006229 (change log)
DescriptionChlamydomonas reinhardtii miR1169 stem-loop
Stem-loop
                                               caa 
5' uacgguauccagcaagcaacauccacauaagccgggguugguag   c
   ||||||||||||||||||||||||||||||||||||||||||||    
3' gugccauaggucguucguuguagguguauucggccccaaccauc   a
                                               uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_46: 613349-613444 [+]
intergenic
Database links

Mature sequence cre-miR1169-5p

Accession MIMAT0005426
Previous IDscre-miR1169*
Sequence

6 - 

uauccagcaagcaacauccaca

 - 27

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1169-3p

Accession MIMAT0005427
Previous IDscre-miR1169
Sequence

70 - 

uguggauguugcuugcuggau

 - 90

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).