Stem-loop sequence cre-MIR1170

AccessionMI0006230 (change log)
DescriptionChlamydomonas reinhardtii miR1170 stem-loop
Stem-loop
           a    a                           cacaaugu               c            -----cu      
5' uaugggca uacu aaacuggcaacuuggcgauggacaugu        caguucugccguguu ggcugauugagc       ggucu 
   |||||||| |||| |||||||||||||||||||||||||||        ||||||||||||||| ||||||||||||       |||| c
3' auacccgu auga uuugaccguugaaccgcuaccuguacg        gucaagacggcacaa ccgacuaacucg       ccaga 
           c    c                           --------               a            acuaacu      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_5: 4560-4725 [+]
intergenic
Database links

Mature sequence cre-miR1170.2

Accession MIMAT0005428
Sequence

102 - 

aaucagccaaacacggcaga

 - 121

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1170.1

Accession MIMAT0005429
Sequence

129 - 

uguccaucgccaaguugccag

 - 149

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).