Stem-loop sequence cre-MIR1173

AccessionMI0006232 (change log)
DescriptionChlamydomonas reinhardtii miR1173 stem-loop
Stem-loop
        gcc    ----gu         u        u   c               c         u               u                              aagugugcu   c        a    --                 c             g                   a         c                  uauacca                    agaugucccugcacuagcaggcauucagac 
5' guuug   uggu      uuaauuugc uccacaca uug aaugccagcaaauug gcaugccaa gcauuuauagguuau gcauacgcccuggauuggcagcgugaguga         ggg ugcgugcu cugu  agaugaguggguacuug gaaauguauuggc gccauuguaugguugcaau gaaaucaug aggggauacugugaauua       uguaccaugugcaauguuuc                              a
   |||||   ||||      ||||||||| |||||||| ||| ||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||         ||| |||||||| ||||  ||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||       ||||||||||||||||||||                               
3' caaac   acca      aauuagacg aggugugu aac uuacggucguuuaac cguacgguu cguaaauauccaaua cguaugcgggaccuaaccgucguacucacu         ucc acgcacga gaca  ucuacucacccaugaac cuuuacauaaccg cgguaacauaccaauguua cuuuaguac uccccuaugacacuuaau       acaugguacacguuacaaag                              u
        ---    auguuc         u        c   a               a         u               u                              ---------   -        c    ug                 u             a                   c         u                  -------                    uccguacggacggucgcgacccuacgaccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Molner et al. cloned a number of additional minor products (cloned only once) from this hairpin precursor (not shown) [1].

Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_6: 1969701-1970232 [+]
intergenic
Database links

Mature sequence cre-miR1173

Accession MIMAT0005431
Sequence

176 - 

augguugcaauagaaaucaug

 - 196

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).