Stem-loop sequence cre-MIR1172

AccessionMI0006233 (change log)
DescriptionChlamydomonas reinhardtii miR1172 stem-loop
Stem-loop
          a     g  g     a      c                  c g        c         
5' caguagg ucgga ac cagug agcccc uugcugcugcgauucuuu c acuuacaa gugcucgu 
   ||||||| ||||| || ||||| |||||| |||||||||||||||||| | |||||||| ||||||| g
3' gucaucu agccu ug gucgc ucgggg aacgacgacguuaggaga g uggauguu cacgagcg 
          a     g  a     c      c                  u -        a         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_76: 233228-233363 [+]
intergenic
Database links

Mature sequence cre-miR1172.2

Accession MIMAT0005432
Sequence

4 - 

uaggaucggagacgcagugaa

 - 24

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1172.1

Accession MIMAT0005433
Sequence

91 - 

aggauugcagcagcaacggggc

 - 112

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).