Stem-loop sequence cre-MIR1167

AccessionMI0006234 (change log)
DescriptionChlamydomonas reinhardtii miR1167 stem-loop
Stem-loop
      ca   ugc             ccaccgugcaccuucacgcu 
5' gag  uca   aucguuacacccc                    c
   |||  |||   |||||||||||||                    a
3' uuc  agu   uaguagugugggg                    u
      aa   --u             uucguacgugucacgacgcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_10: 2068926-2069014 [-]
intergenic
Database links

Mature sequence cre-miR1167

Accession MIMAT0005434
Sequence

68 - 

ggggugugaugauuugaaac

 - 87

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).