Stem-loop sequence cre-MIR1144b

AccessionMI0006235 (change log)
DescriptionChlamydomonas reinhardtii miR1144b stem-loop
Gene family MIPF0000432; MIR1144
Literature search

1 open access papers mention cre-MIR1144b
(1 sentences)

Stem-loop
       a ca    --    -----a     c    c  a   g   -ag    g g  a      a   cu             g   u  u    c      acc 
5' gugc g  ggcu  uggu      ccggg acgc gg ggu ggu   ugug c gc ggcagc ggc  cgcggggcugcug ugg gg ggag aggacg   g
   |||| |  ||||  ||||      ||||| |||| || ||| |||   |||| | || |||||| |||  ||||||||||||| ||| || |||| ||||||   g
3' cacg c  ccgg  gcca      ggccc ugcg cc cca cca   acac g cg ccgucg ccg  gcgccccggcgac acc cc ccuc uccugc   c
       a ac    gu    caaauc     a    a  c   a   cua    - a  c      a   uc             a   u  u    c      ccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cre-miR1144b

Accession MIMAT0005435
Sequence

34 - 

uggguaguguggcggcaggcag

 - 55

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).