Stem-loop sequence cre-MIR1159

AccessionMI0006236 (change log)
DescriptionChlamydomonas reinhardtii miR1159 stem-loop
Stem-loop
     u  a                  a  u c -                        a       auucca  a    c    ---c       ---   cacg      a  c    u 
5' cg cg caaucgggcacuguggca ac g g acaaugccaauggagacggaugag ccguguu      gc gccg gacu    cuggaau   ggu    cggcug gg accc u
   || || |||||||||||||||||| || | | |||||||||||||||||||||||| |||||||      || |||| ||||    |||||||   |||    |||||| || |||| g
3' gc gc guuagcccgugacaccgu ug c c uguuacgguuaccucugccuacuc ggcacga      cg cggc cuga    gaccuug   ccg    gccgac cc uggg c
     c  c                  c  c a a                        c       caccga  g    a    cgcc       uag   --ua      c  a    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cre-miR1159.2

Accession MIMAT0005436
Sequence

32 - 

acaaugccaauggagacggau

 - 52

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1159.1

Accession MIMAT0005437
Sequence

207 - 

ugccacagugcccgauugccg

 - 227

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).