Stem-loop sequence aga-mir-12

AccessionMI0006240 (change log)
DescriptionAnopheles gambiae miR-12 stem-loop
Gene family MIPF0000181; mir-12
Literature search

2 open access papers mention aga-mir-12
(9 sentences)

Stem-loop
   ccgg  u      u   u            u  aauuuaaacgaccaucggacauggggg 
5'     gg gaguau aca cagguacuggug gu                           c
       || |||||| ||| |||||||||||| ||                           u
3'     cc cucaua ugu guucaugacuau cg                           g
   ----  u      u   -            -  aacuggccccugucuucuccucaaccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 37888037-37888153 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-12
aga-mir-283chr2R: 37890034-37890125 [-]
aga-mir-1889chr2R: 37888789-37888919 [-]
aga-mir-12chr2R: 37888037-37888153 [-]
Database links

Mature sequence aga-miR-12

Accession MIMAT0005527
Sequence

7 - 

ugaguauuacaucagguacuggu

 - 29

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17933784 "Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion" Winter F, Edaye S, Huttenhofer A, Brunel C Nucleic Acids Res. 35:6953-6962(2007).