Stem-loop sequence aga-mir-996

AccessionMI0006241 (change log)
DescriptionAnopheles gambiae miR-996 stem-loop
Gene family MIPF0000449; mir-996
Literature search

1 open access papers mention aga-mir-996
(1 sentences)

Stem-loop
          u      uu      a    uuuucag 
5' guaggcg gcaugu  ucuagu cacg       u
   ||||||| ||||||  |||||| ||||        
3' uaucugc cguaca  agauca gugc       u
          u      uu      -    uuugaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 55572842-55572910 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-996
aga-mir-279chr2R: 55573327-55573415 [-]
aga-mir-996chr2R: 55572842-55572910 [-]
Database links

Mature sequence aga-miR-996

Accession MIMAT0005528
Sequence

46 - 

ugacuagauuacaugcucgucu

 - 67

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17933784 "Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion" Winter F, Edaye S, Huttenhofer A, Brunel C Nucleic Acids Res. 35:6953-6962(2007).