Stem-loop sequence aga-mir-989

AccessionMI0006242 (change log)
DescriptionAnopheles gambiae miR-989 stem-loop
Gene family MIPF0000885; mir-989
Literature search

6 open access papers mention aga-mir-989
(36 sentences)

Stem-loop
   ggaca  aca    c        uac          ug uu    u   uacgcucguauaguauag 
5'      gu   gugg cacggggg   gccgcuacgu  c  ucac ugg                  a
        ||   |||| ||||||||   ||||||||||  |  |||| |||                   
3'      ca   uauc gugcccuc   uggugaugca  g  agug acc                  g
   --caa  --c    u        cca          gu -u    u   uagauacaaaugaaaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3L: 2905395-2905525 [+]
intergenic
Database links

Mature sequence aga-miR-989

Accession MIMAT0005529
Sequence

91 - 

ugugaugugacguagugguac

 - 111

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17933784 "Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion" Winter F, Edaye S, Huttenhofer A, Brunel C Nucleic Acids Res. 35:6953-6962(2007).