Stem-loop sequence aga-mir-306

AccessionMI0006243 (change log)
DescriptionAnopheles gambiae miR-306 stem-loop
Literature search

1 open access papers mention aga-mir-306
(13 sentences)

Stem-loop
       a   -uc      ug  u a        ugugug 
5' ucac ugg   agguac  ga g cucucagu      u
   |||| |||   ||||||  || | ||||||||       
3' agug acc   uccaug  cu c gggagucg      a
       -   cca      gu  u c        uagaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 5888600-5888675 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-306
aga-mir-9cchr3R: 5891167-5891256 [-]
aga-mir-306chr3R: 5888600-5888675 [-]
aga-mir-79chr3R: 5888298-5888391 [-]
aga-mir-9bchr3R: 5887786-5887878 [-]
Database links

Mature sequence aga-miR-306

Accession MIMAT0005530
Sequence

9 - 

ucagguacuggaugacucucag

 - 30

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17933784 "Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion" Winter F, Edaye S, Huttenhofer A, Brunel C Nucleic Acids Res. 35:6953-6962(2007).