Stem-loop sequence mcmv-mir-m01-2

AccessionMI0006247 (change log)
DescriptionMouse cytomegalovirus miR-m01-2 stem-loop
Stem-loop
   gga     ag     g    g       u   uua 
5'    ugaag  aaucg guug aacggug uuc   a
      |||||  ||||| |||| ||||||| |||    
3'    gcuuc  uuggc cagc uugccau gag   g
   uca     cu     a    -       c   cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-m01-2-5p

Accession MIMAT0005534
Previous IDsmcmv-miR-m01-2
Sequence

5 - 

gaagagaaucggguuggaacggu

 - 27

Get sequence
Evidence experimental; cloned [1-2]

Mature sequence mcmv-miR-m01-2-3p

Accession MIMAT0005535
Previous IDsmcmv-miR-m01-2*
Sequence

48 - 

cguucgacacgguuuccuucga

 - 69

Get sequence
Evidence experimental; cloned [1-2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).