Stem-loop sequence mcmv-mir-m01-3

AccessionMI0006248 (change log)
DescriptionMouse cytomegalovirus miR-m01-3 stem-loop
Stem-loop
   -   g         c    g      aacaua 
5'  agc gugaagcga uguu ccucga      c
    ||| ||||||||| |||| ||||||      g
3'  ucg cacuucgcu gcaa ggagcu      g
   c   g         c    -      cgcggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-m01-3-5p

Accession MIMAT0005536
Previous IDsmcmv-miR-m01-3
Sequence

3 - 

cggugaagcgacuguugccucga

 - 25

Get sequence
Evidence experimental; cloned [1-2]

Mature sequence mcmv-miR-m01-3-3p

Accession MIMAT0005537
Previous IDsmcmv-miR-m01-3*
Sequence

42 - 

cgaggaacgcucgcuucacggc

 - 63

Get sequence
Evidence experimental; cloned [1-2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).