Stem-loop sequence mcmv-mir-m01-4

AccessionMI0006249 (change log)
DescriptionMouse cytomegalovirus miR-m01-4 stem-loop
Stem-loop
   ga   cu      a      -    --u    c 
5'   uuc  augcua cacgug cgcg   gaca u
     |||  |||||| |||||| ||||   |||| a
3'   aag  uacgau gugcgc gcgc   cugu c
   cc   au      g      c    ucu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-m01-4-5p

Accession MIMAT0005538
Previous IDsmcmv-miR-m01-4
Sequence

4 - 

uccuaugcuaacacgugcgcgug

 - 26

Get sequence
Evidence experimental; cloned [1-2]

Mature sequence mcmv-miR-m01-4-3p

Accession MIMAT0005539
Previous IDsmcmv-miR-m01-4*
Sequence

44 - 

cgccgcgugguagcauuagaac

 - 65

Get sequence
Evidence experimental; cloned [1-2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).