Stem-loop sequence mcmv-mir-m22-1

AccessionMI0006251 (change log)
DescriptionMouse cytomegalovirus miR-m22-1 stem-loop
Gene family MIPF0000451; mir-m22-1
Stem-loop
   --          -  c    ca      c  ucac 
5'   cuggccucgg gc gacg  ggagcc gu    a
     |||||||||| || ||||  |||||| ||    a
3'   gaccggagcc ug cugc  ccuugg ca    u
   ca          a  c    -c      -  caca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-m22-1

Accession MIMAT0005541
Sequence

44 - 

uuccccguccguaccgaggcca

 - 65

Get sequence
Evidence experimental; cloned [1-2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).