Stem-loop sequence mcmv-mir-M23-1

AccessionMI0006252 (change log)
DescriptionMouse cytomegalovirus miR-M23-1 stem-loop
Gene family MIPF0000451; mir-m22-1
Stem-loop
             ua   -a     aa    gugu 
5' cuggccucgg  cgg  cgggg  ccgu    a
   ||||||||||  |||  |||||  ||||    u
3' gaccggagcc  gcu  guccu  ggca    u
             cg   gc     cg    agug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-M23-1-5p

Accession MIMAT0005542
Sequence

6 - 

cucgguacggacggggaaccgu

 - 27

Get sequence
Evidence experimental; cloned [2]

Mature sequence mcmv-miR-M23-1-3p

Accession MIMAT0005543
Sequence

44 - 

cuccugcgucggcccgaggcc

 - 64

Get sequence
Evidence experimental; cloned [1-2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).