Stem-loop sequence mcmv-mir-M95-1

AccessionMI0006260 (change log)
DescriptionMouse cytomegalovirus miR-M95-1 stem-loop
Stem-loop
   --a g       g  ug       uguu  ca 
5'    c gucgugg cu  ugucgcu    ug  a
      | ||||||| ||  |||||||    ||   
3'    g cagcgcc gg  gcagcga    ac  u
   agc g       a  cu       uacu  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-M95-1-5p

Accession MIMAT0005553
Sequence

3 - 

ggucgugggcuugugucgcuug

 - 24

Get sequence
Evidence experimental; cloned [1-2]

Mature sequence mcmv-miR-M95-1-3p

Accession MIMAT0005554
Sequence

41 - 

agcgacgucggaccgcgacggc

 - 62

Get sequence
Evidence experimental; cloned [2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).