Stem-loop sequence mcmv-mir-m108-1

AccessionMI0006262 (change log)
DescriptionMouse cytomegalovirus miR-m108-1 stem-loop
Stem-loop
   --  uu       a    c c      -ug  uc     ccucgu     a     a 
5'   cg  cacgagc accg c gaaaug   gg  uuccg      uacgc cgugu a
     ||  ||||||| |||| | ||||||   ||  |||||      ||||| |||||  
3'   gc  gugcucg uggc g cuuugc   cc  gaggc      augcg gcaua g
   ga  -u       g    a u      uug  uc     ------     -     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-m108-1-5p

Accession MIMAT0005557
Previous IDsmcmv-miR-m108-1*
Sequence

4 - 

ucacgagcaaccgcccgaaaug

 - 25

Get sequence
Evidence experimental; cloned [1]

Mature sequence mcmv-miR-m108-1-3p

Accession MIMAT0005558
Previous IDsmcmv-miR-m108-1
Sequence

82 - 

uuucugacgguggcucgugucg

 - 103

Get sequence
Evidence experimental; cloned [1-2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).