Stem-loop sequence mcmv-mir-m108-2

AccessionMI0006263 (change log)
DescriptionMouse cytomegalovirus miR-m108-2 stem-loop
Gene family MIPF0000446; mir-m107-1
Stem-loop
     u a      gc  g          a g    -     ag     
5' ga c cucguc  ga cggucacucg c cgag caccg  ucgc 
   || | ||||||  || |||||||||| | |||| |||||  ||| u
3' cu g gagcag  cu gccagugagc g gcuc guggc  ggca 
     - c      --  g          a a    a     -a     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Buck et al [1] and Dolken et al [2] cloned alternative offset mature miRNA sequences from the 5' arm of this hairpin precursor, named mir-m108-2-5p.1 and .2 here.

Database links

Mature sequence mcmv-miR-m108-2-5p.2

Accession MIMAT0005559
Sequence

3 - 

ucacucgucgcgagcggucac

 - 23

Get sequence
Evidence experimental; cloned [1]

Mature sequence mcmv-miR-m108-2-5p.1

Accession MIMAT0005560
Sequence

16 - 

gcggucacucgacgcgagcaccg

 - 38

Get sequence
Evidence experimental; cloned [2]

Mature sequence mcmv-miR-m108-2-3p

Accession MIMAT0005561
Sequence

53 - 

gugacucgagacgagugaccggu

 - 75

Get sequence
Evidence experimental; cloned [1-2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).