Stem-loop sequence xtr-mir-146b

AccessionMI0006265 (change log)
DescriptionXenopus tropicalis miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   ccaa     gg   c    cu   a       u ca       uuccacuc 
5'     uggca  gcc ggcu  gag acugaau c  uggacug        a
       |||||  ||| ||||  ||| ||||||| |  |||||||         
3'     accgu  cgg cuga  cuc ugacuug g  accugac        c
   -auc     --   u    -c   g       u ac       ucccacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 8024073-8024172 [+]
sense
ENSXETT00000061248 ; ddrgk1-203; intron 6
ENSXETT00000046531 ; ddrgk1-201; intron 8
ENSXETT00000054575 ; ddrgk1-202; intron 9
Database links

Mature sequence xtr-miR-146b

Accession MIMAT0005563
Sequence

21 - 

ugagaacugaauuccauggacu

 - 42

Get sequence
Evidence by similarity; MI0004665
Predicted targets

References

1