Stem-loop sequence xtr-mir-146b

AccessionMI0006265
DescriptionXenopus tropicalis miR-146b stem-loop
Gene family MIPF0000103; mir-146
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-146. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-146 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-146 is primarily involved in the regulation of inflammation and other process that function in the innate immune system. Loss of functional miR-146 (and mir-145) could predispose an individual to suffer from chromosome 5q deletion syndrome. miR-146 has also been reported to be highly upregulated in osteoarthritis cartilage, and could be involved in its pathogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ccaa     gg   c    cu   a       u ca       uuccacuc 
5'     uggca  gcc ggcu  gag acugaau c  uggacug        a
       |||||  ||| ||||  ||| ||||||| |  |||||||         
3'     accgu  cgg cuga  cuc ugacuug g  accugac        c
   -auc     --   u    -c   g       u ac       ucccacga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173004.1: 119888-119987 [+]
sense
ENSXETT00000061248 ; ddrgk1-203; intron 6
ENSXETT00000046531 ; ddrgk1-201; intron 8
ENSXETT00000054575 ; ddrgk1-202; intron 9

Mature sequence xtr-miR-146b

Accession MIMAT0005563
Sequence

21 - 

ugagaacugaauuccauggacu

 - 42

Get sequence
Evidence by similarity; MI0004665
Predicted targets

References

1