Stem-loop sequence xtr-mir-320

AccessionMI0006266 (change log)
DescriptionXenopus tropicalis miR-320 stem-loop
   -----------------------------------   cc   u   aag aa    gc         -     caa 
5'                                    uuc  ccc gcu   c  uuau  caaucaacu uagug   u
                                      |||  ||| |||   |  ||||  ||||||||| |||||    
3'                                    gag  ggg cga   g  aaua  guuaguuga aucgc   c
   gucauugaaauauggaggucguuuaguacagugga   uu   u   aaa ga    au         c     aca 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr7: 80077496-80077615 [+]
ENSXETT00000061329 ; samd11-201; intron 2
Database links

Mature sequence xtr-miR-320

Accession MIMAT0005564

71 - 


 - 91

Get sequence
Evidence by similarity; MI0000704
Predicted targets
