Stem-loop sequence xtr-mir-320

AccessionMI0006266
DescriptionXenopus tropicalis miR-320 stem-loop
Stem-loop
   -------uucccc   g   a    -     ---  aa          ------------       c  gc 
5'              ccu cua gcaa uuaug   cc  ucaacuuagu            gcaauca ac  u
                ||| ||| |||| |||||   ||  ||||||||||            ||||||| ||   
3'              gga ggu cguu aguac   gg  aguugggucg            uguuagu ug  a
   gucauugaaauau   -   -    u     agu  ag          aaaaggaaauaa       -  ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172843.1: 651337-651456 [-]
antisense
ENSXETT00000061329 ; samd11-201; intron 2

Mature sequence xtr-miR-320

Accession MIMAT0005564
Sequence

71 - 

aaaagcuggguugagagguga

 - 91

Get sequence
Evidence by similarity; MI0000704
Predicted targets

References

1