Stem-loop sequence xtr-mir-375

AccessionMI0006267 (change log)
DescriptionXenopus tropicalis miR-375 stem-loop
Gene family MIPF0000114; mir-375
Stem-loop
   --    ----    c     u    u    u  u     
5'   ccug    acgc gagcc gacg gcaa gc uugu 
     ||||    |||| ||||| |||| |||| || ||| g
3'   ggac    ugcg cucgg uugc uguu ug aacu 
   gu    gaau    -     c    u    u  c     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr9: 77564211-77564280 [-]
intergenic
Database links

Mature sequence xtr-miR-375

Accession MIMAT0005565
Sequence

41 - 

uuuguucguucggcucgcguua

 - 62

Get sequence
Evidence by similarity; MI0003705
Predicted targets

References

1