Stem-loop sequence xtr-mir-427-1

AccessionMI0006268 (change log)
DescriptionXenopus tropicalis miR-427-1 stem-loop
Gene family MIPF0000441; mir-427
Stem-loop
   --   a          --   u  c   ug -   u 
5'   agc cccaaaacgg  ggc cu ucu  u gua g
     ||| ||||||||||  ||| || |||  | ||| a
3'   uug ggguuuuguc  ucg ga aga  g uau a
   ug   c          uu   u  a   gu g   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 133221387-133221456 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-427-1
xtr-mir-427-3chr3: 133301531-133301600 [+]
xtr-mir-427-3chr3: 133273662-133273731 [+]
xtr-mir-427-3chr3: 133272060-133272129 [+]
xtr-mir-427-3chr3: 133270458-133270527 [+]
xtr-mir-427-3chr3: 133268854-133268923 [+]
xtr-mir-427-3chr3: 133267252-133267321 [+]
xtr-mir-427-3chr3: 133265652-133265721 [+]
xtr-mir-427-3chr3: 133264471-133264540 [+]
xtr-mir-427-3chr3: 133262548-133262617 [+]
xtr-mir-427-3chr3: 133260944-133261013 [+]
xtr-mir-427-3chr3: 133259348-133259417 [+]
xtr-mir-427-3chr3: 133255347-133255416 [+]
xtr-mir-427-3chr3: 133253731-133253800 [+]
xtr-mir-427-3chr3: 133252128-133252197 [+]
xtr-mir-427-3chr3: 133250512-133250581 [+]
xtr-mir-427-3chr3: 133243687-133243756 [-]
xtr-mir-427-3chr3: 133241648-133241717 [-]
xtr-mir-427-3chr3: 133240043-133240112 [-]
xtr-mir-427-3chr3: 133238436-133238505 [-]
xtr-mir-427-3chr3: 133234571-133234640 [-]
xtr-mir-427-3chr3: 133230914-133230983 [-]
xtr-mir-427-3chr3: 133229302-133229371 [-]
xtr-mir-427-3chr3: 133226067-133226136 [-]
xtr-mir-427-3chr3: 133224468-133224537 [-]
xtr-mir-427-3chr3: 133222853-133222922 [-]
xtr-mir-427-2chr3: 133222427-133222496 [-]
xtr-mir-427-1chr3: 133221387-133221456 [-]
Database links

Mature sequence xtr-miR-427

Accession MIMAT0005566
Sequence

44 - 

gaaagugcuuucuguuuugggcg

 - 66

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1