Stem-loop sequence xtr-mir-427-1

AccessionMI0006268
DescriptionXenopus tropicalis miR-427-1 stem-loop
Gene family MIPF0000441; mir-427
Stem-loop
   --   a          --   u  c   ug -   u 
5'   agc cccaaaacgg  ggc cu ucu  u gua g
     ||| ||||||||||  ||| || |||  | ||| a
3'   uug ggguuuuguc  ucg ga aga  g uau a
   ug   c          uu   u  a   gu g   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173311.1: 6618-6687 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-427-1
xtr-mir-427-3GL173311.1: 6195-6264 [+]
xtr-mir-427-1GL173311.1: 6618-6687 [+]
xtr-mir-427-3GL173311.1: 7615-7684 [+]
xtr-mir-427-2GL173311.1: 8038-8107 [+]
xtr-mir-427-3GL173311.1: 9230-9299 [+]
xtr-mir-427-3GL173311.1: 37363-37432 [+]

Mature sequence xtr-miR-427

Accession MIMAT0005566
Sequence

44 - 

gaaagugcuuucuguuuugggcg

 - 66

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1