Stem-loop sequence xtr-mir-427-3

AccessionMI0006270
DescriptionXenopus tropicalis miR-427-3 stem-loop
Gene family MIPF0000441; mir-427
Stem-loop
   --   a          --   u  c   ug g      
5'   agc cccaaaacgg  ggc cu ucu  u cauga 
     ||| ||||||||||  ||| || |||  | |||| a
3'   uug ggguuuuguc  ucg ga aga  g guauu 
   ug   c          uu   u  a   gu -      
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173311.1: 6195-6264 [+]
intergenic
GL173311.1: 7615-7684 [+]
intergenic
GL173311.1: 9230-9299 [+]
intergenic
GL173311.1: 37363-37432 [+]
intergenic
GL173316.1: 537160-537229 [-]
intergenic
GL173316.1: 548279-548348 [-]
intergenic
GL173316.1: 558420-558489 [-]
intergenic
GL180153.1: 34068-34137 [-]
intergenic
GL180153.1: 35675-35744 [-]
intergenic
GL180153.1: 36999-37068 [-]
intergenic
GL180153.1: 38061-38130 [-]
intergenic
GL180153.1: 72144-72213 [+]
intergenic
GL180153.1: 107844-107913 [+]
intergenic
GL180153.1: 109417-109486 [+]
intergenic
GL180153.1: 110704-110773 [+]
intergenic
GL180153.1: 116172-116241 [+]
intergenic
GL180607.1: 397-466 [-]
intergenic
GL180607.1: 33274-33343 [-]
intergenic
GL180607.1: 33697-33766 [-]
intergenic
GL180607.1: 35731-35800 [-]
intergenic
GL184521.1: 644-713 [+]
intergenic
GL186668.1: 987-1056 [-]
intergenic
GL186668.1: 6471-6540 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-427-3
xtr-mir-427-3GL173311.1: 6195-6264 [+]
xtr-mir-427-1GL173311.1: 6618-6687 [+]
xtr-mir-427-3GL173311.1: 7615-7684 [+]
xtr-mir-427-2GL173311.1: 8038-8107 [+]
xtr-mir-427-3GL173311.1: 9230-9299 [+]
xtr-mir-427-3GL173311.1: 37363-37432 [+]

Mature sequence xtr-miR-427

Accession MIMAT0005566
Sequence

44 - 

gaaagugcuuucuguuuugggcg

 - 66

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1