WARNING: This summary was generated by AI. MIR663B is a microRNA gene located on chromosome 2, specifically upstream of 2q21.2, and is implicated in various cellular processes in cancer biology [PMC3016268]. It is situated within the intron of the ANKDR30BL gene and has been observed to be down-regulated in patients with certain immune characteristics [PMC7439310]. This down-regulation of MIR663B has been associated with increased expression of genes that can lead to enhanced cell proliferation, migration, and invasion while inhibiting apoptosis [PMC7439310]. MIR663B also plays a role in the regulation of genes such as CCL17, CD40, and PIK3CD in chronic lymphocytic leukemia [PMC7439310]. Furthermore, high expression levels of MIR663B have been correlated with more aggressive cancer features such as distant metastasis and advanced tumor grading in endometrial cancer (EC) patients [PMC5796233]. In EC specifically, suppression of MIR663B has been shown to have oncogenic effects by upregulating Bcl-2 and reducing apoptosis within EC cells [PMC5796233]. Despite these findings, some studies have reported no significant changes in the expression levels of miRNAs including MIR663B over time although there was a trend observed for increased expression [PMC6416171].
ggu ga - u ca - ---- g uc uacc u u u gcc gggc cg ccgg uc cuagg cg g gcugcgg uccc cc guc ||| |||| || |||| || ||||| || | ||||||| |||| || ||| g uGG UCCG GC GGCC GG GGucc gu c cggugcc aggg gg cgg cuu AG U C -C U uuuu g -- --cu u - u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005867 |
| Description | Homo sapiens hsa-miR-663b mature miRNA |
| Sequence | 90 - GGUGGCCCGGCCGUGCCUGAGG - 111 |
| Evidence |
experimental
miRAP [1] |
| Database links |
|
| Predicted targets |
|
|