![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1205 |
|||||
Accession | MI0006338 (change log) | ||||
Symbol | HGNC:MIR1205 | ||||
Description | Homo sapiens miR-1205 stem-loop | ||||
Gene family | MIPF0000609; mir-1205 | ||||
Literature search |
5 open access papers mention hsa-mir-1205 | ||||
Stem-loop |
ga cu --u u uuu u 5' aggc c gcaggguu gc gagg a |||| | |||||||| || |||| c 3' ucug g ugucccaa ug uucc u ug ag ucu c ucc u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-1205 |
|
Accession | MIMAT0005869 |
Sequence |
8 - ucugcaggguuugcuuugag - 27 |
Deep sequencing | 1 reads, 1 experiments |
Evidence | experimental; Northern [1] |
Predicted targets |
|
References |
|
1 |
PMID:18314482
"The identification of microRNAs in a genomically unstable region of human chromosome 8q24"
Mol Cancer Res. 6:212-221(2008).
|