Stem-loop sequence hsa-mir-1205

AccessionMI0006338 (change log)
Symbol HGNC:MIR1205
DescriptionHomo sapiens miR-1205 stem-loop
Gene family MIPF0000609; mir-1205
Literature search

5 open access papers mention hsa-mir-1205
(5 sentences)

Stem-loop 
   ga    cu --u        u  uuu    u 
5'   aggc  c   gcaggguu gc   gagg a
     ||||  |   |||||||| ||   |||| c
3'   ucug  g   ugucccaa ug   uucc u
   ug    ag ucu        c  ucc    u
Get sequence
Deep sequencing
20 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 127960633-127960695 [+]
sense
OTTHUMT00000381637 ; RP11-645E10.1-001; intron 3
ENST00000519319 ; PCAT1-001; intron 3
Database links

Mature sequence hsa-miR-1205

Accession MIMAT0005869
Sequence

8 -  

ucugcaggguuugcuuugag

 - 27

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:18314482 "The identification of microRNAs in a genomically unstable region of human chromosome 8q24" Huppi K, Volfovsky N, Runfola T, Jones TL, Mackiewicz M, Martin SE, Mushinski JF, Stephens R, Caplen NJ Mol Cancer Res. 6:212-221(2008).