Stem-loop sequence hsa-mir-1285-2

Accession

MI0006347 (change log)

Symbol

HGNC:MIR1285-2

Description

Homo sapiens miR-1285-2 stem-loop

Gene family

MIPF0000559; mir-1285

Literature search

25 open access papers mention hsa-mir-1285-2
(69 sentences)

Stem-loop

   --    -      c    cuggugca      --ga      caau   a 
5'   uuug ggaggc gagg        ucacuu    gcccag    uug g
     |||| |||||| ||||        ||||||    ||||||    |||  
3'   aaac ucucug cucc        agugaa    cggguc    aac a
   ag    a      c    ------ag      acaa      ---u   c 

Deep sequencing

9612 reads, 17.7 reads per million, 158 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr2: 70252918-70253005 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000462170 ; AC136007.2-048; intron 2

  OTTHUMT00000462174 ; AC136007.2-044; intron 2

  OTTHUMT00000329422 ; AC136007.2-009; intron 3

  OTTHUMT00000329612 ; AC136007.2-021; intron 3

  OTTHUMT00000329629 ; AC136007.2-038; intron 3

  OTTHUMT00000329614 ; AC136007.2-023; intron 3

  OTTHUMT00000329418 ; AC136007.2-005; intron 4

  OTTHUMT00000329604 ; AC136007.2-013; intron 4

  OTTHUMT00000329613 ; AC136007.2-022; intron 4

  OTTHUMT00000462171 ; AC136007.2-052; intron 4

  OTTHUMT00000329620 ; AC136007.2-029; intron 4

  OTTHUMT00000329420 ; AC136007.2-007; intron 4

  OTTHUMT00000329608 ; AC136007.2-017; intron 4

  OTTHUMT00000329606 ; AC136007.2-015; intron 4

  OTTHUMT00000329421 ; AC136007.2-008; intron 4

  OTTHUMT00000329616 ; AC136007.2-025; intron 4

  OTTHUMT00000329607 ; AC136007.2-016; intron 4

  OTTHUMT00000462173 ; AC136007.2-054; intron 6

  OTTHUMT00000329414 ; AC136007.2-001; intron 7

  ENST00000594376 ; PCBP1-AS1-048; intron 2

  ENST00000601431 ; PCBP1-AS1-044; intron 2

  ENST00000457076 ; PCBP1-AS1-009; intron 3

  ENST00000418564 ; PCBP1-AS1-021; intron 3

  ENST00000415222 ; PCBP1-AS1-038; intron 3

  ENST00000418308 ; PCBP1-AS1-023; intron 3

  ENST00000413436 ; PCBP1-AS1-005; intron 4

  ENST00000456161 ; PCBP1-AS1-013; intron 4

  ENST00000419963 ; PCBP1-AS1-022; intron 4

  ENST00000599673 ; PCBP1-AS1-052; intron 4

  ENST00000452431 ; PCBP1-AS1-029; intron 4

  ENST00000423402 ; PCBP1-AS1-007; intron 4

  ENST00000411429 ; PCBP1-AS1-017; intron 4

  ENST00000420309 ; PCBP1-AS1-015; intron 4

  ENST00000434781 ; PCBP1-AS1-008; intron 4

  ENST00000415742 ; PCBP1-AS1-025; intron 4

  ENST00000457770 ; PCBP1-AS1-016; intron 4

  ENST00000596028 ; PCBP1-AS1-054; intron 6

  ENST00000435880 ; PCBP1-AS1-001; intron 7

Database links

• EntrezGene:MIR1285-2
• HGNC:MIR1285-2
• RNAcentral:URS000075A68E_9606
• miRBase Tracker:MI0006347

Mature sequence hsa-miR-1285-3p

• Accession: MIMAT0005876
• Previous IDs: hsa-miR-1285
• Sequence: 52 - ucugggcaacaaagugagaccu - 73
• Deep sequencing: 17819 reads, 154 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS0000399545_9606
• Predicted targets:
  • TargetMiner:hsa-miR-1285-3p
  • TargetScanVert:hsa-miR-1285-3p
  • miRDB:hsa-miR-1285-3p
  • microrna.org:hsa-miR-1285-3p

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).