![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1291 |
|||||
Accession | MI0006353 (change log) | ||||
Symbol | HGNC:MIR1291 | ||||
Description | Homo sapiens miR-1291 stem-loop | ||||
Gene family | MIPF0000599; mir-1291 | ||||
Literature search |
![]()
11 open access papers mention hsa-mir-1291 | ||||
Stem-loop |
-- u -au -agu - a ga ug 5' gg aga ucc ggcc cug cu agaccagcagu ua || ||| ||| |||| ||| || ||||||||||| | c 3' cc ucu agg ccgg gac ga uuugguugucg gu gu u guc aaau a - ac gu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-1291 |
|
Accession | MIMAT0005881 |
Sequence |
14 - uggcccugacugaagaccagcagu - 37 |
Deep sequencing | 3545 reads, 129 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|