![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-548k |
|||||
Accession | MI0006354 (change log) | ||||
Symbol | HGNC:MIR548K | ||||
Description | Homo sapiens miR-548k stem-loop | ||||
Gene family | MIPF0000317; mir-548 | ||||
Literature search |
![]()
42 open access papers mention hsa-mir-548k | ||||
Stem-loop |
cuuuucucaa c u c a uuac 5' guauug uguuagguugg gcaaaagua uugcgg uuuugcu u |||||| ||||||||||| ||||||||| |||||| ||||||| u 3' cguagu auaauccaacu cguuuuuau aacgcc aaaacgg u ucgguuaaaa - u u a uaau |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-548k |
|
Accession | MIMAT0005882 |
Sequence |
32 - aaaaguacuugcggauuuugcu - 53 |
Deep sequencing | 7154 reads, 142 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|