MIR1247 is a microRNA that has been found to be dense in primary gastric cancer tissue but not in normal gastric cancer tissue [PMC9476644]. It has been shown that MIR1247, along with mir941, is silenced by DNA methylation in multiple gastric cancer cell lines [PMC9476644]. These microRNAs are regulated by gastric cancer DNA methylation transcription and have the ability to inhibit gastric cancer by inhibiting oncogenes [PMC9476644]. In a study comparing tumor tissue to adjacent nontumor tissue, the expression of MIR1247 was not increased in the tumor tissue [PMC7590111]. Inhibitors of MIR1247 have been shown to decrease cell viability across all cell lines [PMC7590111]. PCNXL3 is a gene that has been found to have a high correlation with colon adenocarcinoma and is one of the genes associated with hyper-methylated DMRs along with MIR1247 [PMC5986643]. The regulation of MIR941 and MIR1247 has been associated with gastric cancer cell growth and migration [PMC7541134]. In diabetes, expression changes of MIR1247 were not significantly returned to normal levels by treatment [PMC5114726]. It has been observed that MIR1247 may have different targets in various types of malignancies [PMC5966945]. Stable expression of MIR1247 was achieved through puromycin selection in infected cells, and its methylation levels were decreased by DAC exposure leading to increased expression [PMC6251029].
c u - ---c a c cccc - --c A C C UU C Ac ugc cgcu gc cucg cc gcg ag ggc cg ugggcgc CC GUC CG CGU CCCGG gu u |||| || |||| || ||| || ||| || ||||||| || ||| || ||| ||||| || gcgg cg gagc gg cgc uc ccg gu gcccgCG GG CAG GC GCA GGGCC Ca c - - a ccca - u --ca a caa A U A -U A -C ucu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005899 |
Description | Homo sapiens hsa-miR-1247-5p mature miRNA |
Sequence | 40 - ACCCGUCCCGUUCGUCCCCGGA - 61 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
Accession | MIMAT0022721 |
Description | Homo sapiens hsa-miR-1247-3p mature miRNA |
Sequence | 74 - CCCCGGGAACGUCGAGACUGGAGC - 97 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|