Stem-loop sequence hsa-mir-1249

Accession

MI0006384 (change log)

Symbol

HGNC:MIR1249

Description

Homo sapiens miR-1249 stem-loop

Gene family

MIPF0000667; mir-1249

Literature search

16 open access papers mention hsa-mir-1249
(33 sentences)

Stem-loop

   ----g         a  a  u    caa     cuc 
5'      ggaggaggg gg ga gggc   guucc   u
        ||||||||| || || ||||   |||||    
3'      cuucuuccc cc cu cccg   caagg   g
   gucca         -  c  u    ---     ucg 

Deep sequencing

4969 reads, 9.03 reads per million, 155 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr22: 45200954-45201019 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000157076 ; ARHGAP8-005; intron 1

  OTTHUMT00000321702 ; ARHGAP8-014; intron 1

  OTTHUMT00000321705 ; ARHGAP8-017; intron 2

  OTTHUMT00000075088 ; ARHGAP8-001; intron 3

  OTTHUMT00000157073 ; ARHGAP8-002; intron 3

  OTTHUMT00000321701 ; ARHGAP8-013; intron 3

  OTTHUMT00000157074 ; ARHGAP8-003; intron 3

  OTTHUMT00000157075 ; ARHGAP8-004; intron 3

  OTTHUMT00000157077 ; PRR5-ARHGAP8-004; intron 4

  OTTHUMT00000363127 ; PRR5-ARHGAP8-003; intron 4

  OTTHUMT00000321700 ; ARHGAP8-012; intron 4

  OTTHUMT00000321698 ; ARHGAP8-010; intron 5

  OTTHUMT00000363126 ; PRR5-ARHGAP8-002; intron 6

  OTTHUMT00000363125 ; PRR5-ARHGAP8-001; intron 9

  ENST00000389772 ; ARHGAP8-005; intron 1

  ENST00000498310 ; ARHGAP8-014; intron 1

  ENST00000495219 ; ARHGAP8-017; intron 2

  ENST00000389774 ; ARHGAP8-001; intron 3

  ENST00000460809 ; ARHGAP8-002; intron 3

  ENST00000447333 ; ARHGAP8-013; intron 3

  ENST00000336963 ; ARHGAP8-003; intron 3

  ENST00000356099 ; ARHGAP8-004; intron 3

  ENST00000495250 ; PRR5-ARHGAP8-004; intron 4

  ENST00000515632 ; PRR5-ARHGAP8-003; intron 4

  ENST00000396119 ; ARHGAP8-012; intron 4

  ENST00000412433 ; ARHGAP8-010; intron 5

  ENST00000361473 ; PRR5-ARHGAP8-002; intron 6

  ENST00000389773 ; ARHGAP8-201; intron 6

  ENST00000352766 ; PRR5-ARHGAP8-001; intron 9

  ENST00000517296 ; ARHGAP8-202; intron 9

Database links

• EntrezGene:MIR1249
• HGNC:MIR1249
• RNAcentral:URS000075BEA3_9606
• miRBase Tracker:MI0006384

Mature sequence hsa-miR-1249-5p

• Accession: MIMAT0032029
• Sequence: 4 - aggagggaggagaugggccaaguu - 27
• Deep sequencing: 208 reads, 39 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS0000782078_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-1249-5p
  • miRDB:hsa-miR-1249-5p

Mature sequence hsa-miR-1249-3p

• Accession: MIMAT0005901
• Previous IDs: hsa-miR-1249
• Sequence: 41 - acgcccuucccccccuucuuca - 62
• Deep sequencing: 4756 reads, 152 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS000060AABB_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-1249-3p
  • miRDB:hsa-miR-1249-3p
  • microrna.org:hsa-miR-1249-3p

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).