WARNING: This summary was generated by AI. MIR1256 is a microRNA implicated in prostate cancer [PMC7920560]. It was one of the miRNAs overexpressed in ameloblastoma tumors identified by microarray analysis [PMC5354851]. However, when MIR1256 was selected for validation through stem loop qPCR, its expression was found to be inconsistent among ameloblastoma and non-ameloblastoma controls [PMC5354851]. In the context of cancer progression, MIR1256 has been associated with alterations in gastric, thyroid, and brain cancers [PMC9775590]. Interactome analysis has shown that MIR1256 can bind to circHECTD1 with the involvement of the Ago2 complex [PMC7216265]. In a study examining genetic alterations in patients with various cancers, gains covering MIR1256 were observed in some patients [PMC9775590], and it was noted that the hazard ratio (HR) for alterations was less than one for MIR1256 [PMC8108987], suggesting a complex role in cancer biology.
------ gc uuugaagcuuu c G AC u a
aguca cuguugaagc gaug cA GCAUUGACUUCUC UAGCUg ga
||||| |||||||||| |||| || ||||||||||||| |||||| || a
ucggu gauaacuuug cuac gu cguaacugaagag aucgau cu
acuuug -a ---------uu a a aa c g
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005907 |
| Description | Homo sapiens hsa-miR-1256 mature miRNA |
| Sequence | 35 - AGGCAUUGACUUCUCACUAGCU - 56 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|