![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-548m |
|||||
Accession | MI0006400 (change log) | ||||
Symbol | HGNC:MIR548M | ||||
Description | Homo sapiens miR-548m stem-loop | ||||
Gene family | MIPF0000317; mir-548 | ||||
Literature search |
![]()
43 open access papers mention hsa-mir-548m | ||||
Stem-loop |
-- u
5' auauuagguuggugcaaagguauuugugguuuuug cauuaa
||||||||||||||||||||||||||||||||||| ||||| a
3' uauaauccaaccacguuuccauaaacaccgaaaac guaaug
au -
|
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-548m |
|
Accession | MIMAT0005917 |
Sequence |
15 - caaagguauuugugguuuuug - 35 |
Deep sequencing | 161 reads, 61 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|