miRBase entry: hsa-mir-1276

Stem-loop hsa-mir-1276


Accession
MI0006416
Symbol
HGNC: MIR1276
Description
Homo sapiens hsa-mir-1276 precursor miRNA
Gene family
MIPF0000652; mir-1276

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1276 is a direct target gene of NF-κB in HeLa and HepG2 cells, and its expression is repressed by NF-κB [PMC7177739]. NF-κB upregulates the expression of CASP9 by directly binding to CASP9, but represses the expressions of MIR1276 and its host gene KLHL25 [PMC7177739]. CASP9 is a true target gene of MIR1276 [PMC7177739]. The level of snRNA U6 expression is used for the normalization of MIR1276 expression [PMC7177739'>PMC7177739'>PMC7177739'>PMC7177739]. TargetScan and DIANA-microT-CDS programs were used to predict the binding of MIR1276 to CASP9 mRNA, and it was confirmed that MIR1276 specifically binds to the 3′UTR of CASP9 [PMC7177739]. The expressions of MIR1276 and its host gene KLHL25 are similar in various cell types [PMC7177739]. NF-κB indirectly enhances CASP9 expression by directly repressing the expression of MIR1276 [PMC7177739]. The regulation between NF-κB, MIR1276, and CASP9 forms a coherent feed-forward loop (FFL) that upregulates the mRNA and protein levels of CASP9 in TNFα-treated cells [PMC7177739].


Sequence

768 reads, 29 reads per million, 51 experiments
ccccagcuaggUAAAGAGCCCUGUGGAGACAccuggauucagagaacaugucuccacugagcacuugggccuugauggcggcu
(((((...((((.(((.((.(.(((((((((((((....))).)....))))))))).).)).)))..))))...))).))..

Structure
--  -   gcu    -A   A  C U         ---- -   g 
  cc cca   aggU  AAG GC C GUGGAGACA    c cug a
  || |||   ||||  ||| || | |||||||||    | |||  
  gg ggu   uccg  uuc cg g caccucugu    g gac u
uc  c   agu    gg   a  a u         acaa a   u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr15: 85770496-85770578 [-]

Disease association
hsa-mir-1276 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1276

Accession MIMAT0005930
Description Homo sapiens hsa-miR-1276 mature miRNA
Sequence 12 - UAAAGAGCCCUGUGGAGACA - 31
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621