Accession
MI0006420
Symbol
HGNC:
MIR548P
Description
Homo sapiens
hsa-mir-548p precursor miRNA
Gene family
MIPF0000317;
mir-548
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR548P is a microRNA that has been found to significantly decrease lipoprotein production and lipid synthesis in hepatocytes. It achieves this by lowering the activity of 3-hydroxy 3-methylglutarylCoA reductase and long-chain acylCoA synthetase ACSL471, which are involved in cholesterol and fatty acid synthesis. However, MIR548P does not affect fatty acid oxidation [PMC7123062]. MIR548P interacts with the 3′-untranslated region of the APOB mRNA, leading to its post-transcriptional degradation and reducing ApoB synthesis and secretion from hepatocytes [PMC7123062]. It has been found that MIR548P reduces ApoB secretion and lipid synthesis through its effects on HMGCoAR and long-chain fatty acylCoA synthase ACSL4 [PMC7123062]. In the context of esophageal squamous cell carcinoma (ESCC), high expression of MIR548P, along with TRAV39, has been associated with a poor prognosis due to the promotion of antitumor immunity [PMC9509226]. Additionally, MIR548P expression was found to be negatively associated with activated mast cells but positively associated with activated T cell CD4 memory cells [PMC9509226]. The expression levels of MIR548P were also found to be correlated with the immune microenvironment in ESCC patients [PMC9509226]. Furthermore, low expression levels of MIR548P were associated with a lower 5-year overall survival rate in ESCC patients [PMC9509226'>PMC9509226]. However, there was no evidence supporting a positive link between the expression of MIR548P and clinicopathological characteristics in ESCC patients [PMC9509226]. Overall, TRAV39 and MIR548P expressions may serve as predictors for clinical outcomes in ESCC patients by reflecting the status of the tumor microenvironment [PMC9509226].
Literature search
42 open access papers mention hsa-mir-548p
(142 sentences)
(142 sentences)
Sequence
359
reads,
31
reads per million, 49 experiments
auuagguugguauaaaauuaauugcaguuuuugucauuacuuucaaUAGCAAAAACUGCAGUUACUUUugcaccaauguaauac
((((.((((((.(((((.((((((((((((((((.(((......))).)))))))))))))))).))))).)))))).))))..
((((.((((((.(((((.((((((((((((((((.(((......))).)))))))))))))))).))))).)))))).))))..
Structure
-- g a u c ac auua guuggu uaaaa uaauugcaguuuuugu auu u |||| |||||| ||||| |||||||||||||||| ||| uaau uaacca guUUU AUUGACGUCAAAAACG Uaa u ca g c C A cu
Annotation confidence
Not enough data
Do you think this miRNA is real?
Genome context
chr5: 100816482-100816565 [-]
Disease association
hsa-mir-548p is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-548p
| Accession | MIMAT0005934 |
| Description | Homo sapiens hsa-miR-548p mature miRNA |
| Sequence | 47 - UAGCAAAAACUGCAGUUACUUU - 68 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
References
|
