Stem-loop vvi-MIR156a

Accession

MI0006485

Description

Vitis vinifera vvi-MIR156a precursor miRNA

Gene family

MIPF0000008; MIR156

Literature search

12 open access papers mention vvi-MIR156a
(100 sentences)

Sequence

23197 reads, 1556 reads per million, 2 experiments

agaaauauguUGACAGAAGAGAGGGAGCACaacccagcaucagcuaaagacucuuugcuuuucuugggagugugcucucucuucuucugucaucaucacacucc
......(((.(((((((((((((((((((((.(((((.(..(((.((((...)))))))..).)))))..))))))))))).)))))))))).)))........

Structure

--agaaau   u          -           -a     c uc   u    a 
        aug UGACAGAAGA GAGGGAGCACa  cccag a  agc aaag  
        ||| |||||||||| |||||||||||  ||||| |  ||| |||| c
        uac acugucuucu cucucucgugu  ggguu u  ucg uuuc  
ccucacac   u          u           ga     c uu   -    u 

Annotation confidence Not enough data

Genome context

chr19: 8708913-8709016 [-]

Mature vvi-miR156a

• Accession: MIMAT0005640
• Description: Vitis vinifera vvi-miR156a mature miRNA
• Sequence: 11 - UGACAGAAGAGAGGGAGCAC - 30
• Evidence: experimental ; Array [2]

References

1. PubMed ID: 17721507
   The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
   "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
   "Nature (2007) 449:463-467


2. PubMed ID: 19939267
   High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
   Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
   BMC Genomics (2009) 10:558