Stem-loop sequence vvi-MIR156a

AccessionMI0006485 (change log)
DescriptionVitis vinifera miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

12 open access papers mention vvi-MIR156a
(99 sentences)

Stem-loop
   --agaaau   u          -           -a     c uc   u      
5'         aug ugacagaaga gagggagcaca  cccag a  agc aaaga 
           ||| |||||||||| |||||||||||  ||||| |  ||| |||| c
3'         uac acugucuucu cucucucgugu  ggguu u  ucg uuucu 
   ccucacac   u          u           ga     c uu   -      
Get sequence
Deep sequencing
414398 reads, 2.76e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr19: 8708913-8709016 [-]
intergenic
Database links

Mature sequence vvi-miR156a

Accession MIMAT0005640
Sequence

11 - 

ugacagaagagagggagcac

 - 30

Get sequence
Deep sequencing414386 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).