Stem-loop sequence vvi-MIR156b

AccessionMI0006486 (change log)
DescriptionVitis vinifera miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

11 open access papers mention vvi-MIR156b
(95 sentences)

Stem-loop
   --     a  a         -     -       a         uu     a 
5'   cauug aa cugacagaa gagag ugagcac cagaggcaa  guaua g
     ||||| || ||||||||| ||||| ||||||| |||||||||  |||||  
3'   gugac uu gacugucuu cucuu acucgug guuuucguu  cguau u
   cc     c  c         u     u       c         uu     u 
Get sequence
Deep sequencing
400406 reads, 2.64e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr4: 5356999-5357100 [-]
intergenic
Database links

Mature sequence vvi-miR156b

Accession MIMAT0005641
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Deep sequencing400368 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).