Stem-loop sequence vvi-MIR156e

AccessionMI0006489 (change log)
DescriptionVitis vinifera miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

11 open access papers mention vvi-MIR156e
(93 sentences)

Stem-loop
   --  a   ua         --  a          u  u   ucuu   uu     aa 
5'   gu ugg  ggugacaga  gg gagugagcac ca ggu    uuc  gcaug  g
     || |||  |||||||||  || |||||||||| || |||    |||  |||||  u
3'   cg acu  ccacugucu  cc cucauucgug gu ucg    aag  cguau  u
   ua  a   cc         au  -          u  c   ----   uu     cu 
Get sequence
Deep sequencing
389478 reads, 2.6e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 1504194-1504301 [-]
intergenic
Database links

Mature sequence vvi-miR156e

Accession MIMAT0005644
Sequence

11 - 

ugacagaggagagugagcac

 - 30

Get sequence
Deep sequencing389478 reads, 2 experiments
Evidence by similarity; MI0000183

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).