Stem-loop sequence vvi-MIR156f

AccessionMI0006490 (change log)
DescriptionVitis vinifera miR156f stem-loop
Gene family MIPF0000008; MIR156
Literature search

12 open access papers mention vvi-MIR156f
(94 sentences)

Stem-loop
   --uuau             a   -u      c   --    aa  u  c    a 
5'       guucuguugacag aga  agagag aca  acug  ca ac caag g
         ||||||||||||| |||  |||||| |||  ||||  || || ||||  
3'       caagacaacuguc ucu  ucucuc ugu  ugac  gu ug guuc g
   gucguu             c   uc      c   uc    ga  u  u    g 
Get sequence
Deep sequencing
6910072 reads, 4.62e+05 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr14: 26463671-26463775 [+]
intergenic
Database links

Mature sequence vvi-miR156f

Accession MIMAT0005645
Sequence

11 - 

uugacagaagauagagagcac

 - 31

Get sequence
Deep sequencing6910071 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).