Stem-loop sequence vvi-MIR156i

AccessionMI0006492 (change log)
DescriptionVitis vinifera miR156i stem-loop
Gene family MIPF0000008; MIR156
Literature search

11 open access papers mention vvi-MIR156i
(92 sentences)

Stem-loop
   --------     cguugu          -             u  -   a    aag 
5'         gguga      ugacagaaga uagagagcacaga ga uga augc   g
           |||||      |||||||||| ||||||||||||| || ||| ||||   a
3'         ccacu      acugucuucu aucucucguguuu cu acu uacg   g
   ccggaauu     ------          u             c  c   c    acc 
Get sequence
Deep sequencing
6910094 reads, 4.62e+05 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr14: 19727077-19727179 [-]
intergenic
Database links

Mature sequence vvi-miR156i

Accession MIMAT0005647
Sequence

11 - 

uugacagaagauagagagcac

 - 31

Get sequence
Deep sequencing6910083 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).