miRBase entry: vvi-MIR159a

Stem-loop vvi-MIR159a


Accession
MI0006493
Description
Vitis vinifera vvi-MIR159a precursor miRNA
Gene family
MIPF0000010; MIR159

Literature search
7 open access papers mention vvi-MIR159a
(14 sentences)

Sequence

1 reads, 0 reads per million, 1 experiments
ggguuuaugggagcuccuuuacgcuccaguucugaaaggagaugaugguauccacagcugcugguucaugaguaccuauggcugcacaauauauauagcaauguugugugcaaacuaugggugugcaugaccucggagaagugguugccuugaucuuucuggcCUUGGAGUGAAGGGAGCUCUCauaacccuuc
(((((.((((((((((((((.((((((((..(((...((((((.(.((((.((((..((.(.(((.((((..(((((((((.((((((..((((......))))..))))))..)))))))))..)))))))..).))..)))).)))).).)))))).)))..)))))))))))))))))))))))))))...

Structure
---     u              a        uu   aaa      g u    u    ag  g -u   u    ag         -c      au    au 
   ggguu augggagcuccuuu cgcuccag  cug   ggagau a ggua ccac  cu c  ggu caug  uaccuaugg  ugcaca  auau  a
   ||||| |||||||||||||| ||||||||  |||   |||||| | |||| ||||  || |  ||| ||||  |||||||||  ||||||  ||||   
   cccaa uaCUCUCGAGGGAA GUGAGGUU  ggu   uuucua u ccgu ggug  ga g  cca guac  guggguauc  acgugu  ugua  g
cuu     -              -        Cc   --c      g u    u    aa  g cu   -    gu         aa      gu    ac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr15: 18469173-18469366 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR159a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR159a

Accession MIMAT0005648
Description Vitis vinifera vvi-miR159a mature miRNA
Sequence 164 - CUUGGAGUGAAGGGAGCUCUC - 184
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558