Stem-loop sequence vvi-MIR159c

AccessionMI0006495 (change log)
DescriptionVitis vinifera miR159c stem-loop
Gene family MIPF0000010; MIR159
Literature search

5 open access papers mention vvi-MIR159c
(16 sentences)

Stem-loop
   --uuuu  a            ga       ua        -u   -      au  -    g    cu    g uc      c       --c   aa 
5'       gg guggagcuccuu  aguccaa  gagggucu  acu ggguag  ug agcu cuga  uaug a  ccacag ccuaucc   guc  u
         || ||||||||||||  |||||||  ||||||||  ||| ||||||  || |||| ||||  |||| |  |||||| |||||||   |||  g
3'       cc caucucgaggga  uuagguu  uuccuaga  uga ccuauu  ac ucga gacu  auac u  gguguu ggauagg   cgg  g
   cucucu  a            ag       ug        uu   a      --  g    g    cu    g uc      c       uua   gg 
Get sequence
Deep sequencing
19207 reads, 1.05e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 2609205-2609394 [-]
intergenic
Database links

Mature sequence vvi-miR159c

Accession MIMAT0005650
Sequence

160 - 

uuuggauugaagggagcucua

 - 180

Get sequence
Deep sequencing17985 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).