Stem-loop sequence vvi-MIR160a

AccessionMI0006496 (change log)
DescriptionVitis vinifera miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

4 open access papers mention vvi-MIR160a
(11 sentences)

Stem-loop
   ------     ugau    c       -    a     u   a    cuu     g 
5'       ggggu    cugc uggcucc cuga ugcca cua gaag   gucaa g
         |||||    |||| ||||||| |||| ||||| ||| ||||   ||||| u
3'       ccccg    gacg acugagg gacu acggu gau cuuc   caguu u
   uuacaa     ----    u       a    -     u   c    ucu     g 
Get sequence
Deep sequencing
205 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr12: 10147157-10147259 [-]
intergenic
Database links

Mature sequence vvi-miR160a

Accession MIMAT0005651
Sequence

11 - 

ugccuggcucccugaaugccauc

 - 33

Get sequence
Deep sequencing137 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).