Stem-loop sequence vvi-MIR160e

AccessionMI0006501 (change log)
Previous IDsvvi-MIR160f
DescriptionVitis vinifera miR160e stem-loop
Gene family MIPF0000032; MIR160
Literature search

4 open access papers mention vvi-MIR160e
(22 sentences)

Stem-loop
   ----uaa     ua   c       cu          ug ag  c   c   c 
5'        gcaua  ugc uggcucc  guaugccauu  c  ag cca cgg a
          |||||  ||| |||||||  ||||||||||  |  || ||| |||  
3'        cguau  acg accgagg  uaugcgguag  g  uc ggu gcu c
   ucuaccc     --   u       ag          gu cu  c   a   a 
Get sequence
Deep sequencing
1369 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence vvi-miR160e

Accession MIMAT0005656
Previous IDsvvi-miR160f
Sequence

11 - 

ugccuggcucccuguaugcca

 - 31

Get sequence
Deep sequencing150 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).