Stem-loop sequence vvi-MIR164b

AccessionMI0006504 (change log)
DescriptionVitis vinifera miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

5 open access papers mention vvi-MIR164b
(16 sentences)

Stem-loop
   --uaaa   u cu     ag           cu     aa    cac 
5'       cca g  ggaga  cagggcacaug  ggauc  ucag   c
         ||| |  |||||  |||||||||||  |||||  ||||   u
3'       ggu c  ccucu  gucccguguac  uuuag  aguc   g
   auccua   u ac     cg           au     --    uag 
Get sequence
Deep sequencing
101575 reads, 6.75e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr9: 514758-514850 [-]
intergenic
Database links

Mature sequence vvi-miR164b

Accession MIMAT0005659
Sequence

11 - 

uggagaagcagggcacaugcu

 - 31

Get sequence
Deep sequencing101575 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).