Stem-loop sequence vvi-MIR169y

AccessionMI0006522 (change log)
DescriptionVitis vinifera miR169y stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

8 open access papers mention vvi-MIR169y
(17 sentences)

Stem-loop
   --c  ug  u   a  g     u        uac    u c   -     ucaaaaua       -----    uaccuuugaucaaaugauucaagaaacaaaagaaaagaaaggccauggcagccaucca 
5'    gu  uu ggu gc aagga gacuugcc   agcc c uua agguu        ccgagcu     uguc                                                          u
      ||  || ||| || ||||| ||||||||   |||| | ||| |||||        |||||||     ||||                                                           
3'    cg  ag cca cg uuccu cugaacgg   uugg g aau ucuaa        gguucga     acag                                                          c
   cuc  gu  u   -  g     -        uau    u u   a     --------       uuauc    cacaaguaagaguucuuacugagguuaaagauaucuuguacuaagaguacaacugaga 
Get sequence
Deep sequencing
283 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr1: 22233573-22233820 [+]
intergenic
Database links

Mature sequence vvi-miR169y

Accession MIMAT0005677
Sequence

11 - 

uagcgaaggaugacuugccua

 - 31

Get sequence
Deep sequencing280 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).