Stem-loop sequence vvi-MIR169f

AccessionMI0006526 (change log)
DescriptionVitis vinifera miR169f stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169f
(19 sentences)

Stem-loop
   ----    -u    gugc       g ug       gaaaauaauuugcucgaucguuaaugugcuucuccaguuucuauugcaauuuaugcaua 
5'     gaua  uaug    agccaag a  acuugcc                                                           g
       ||||  ||||    ||||||| |  |||||||                                                            
3'     cuau  guac    ucgguuu u  ugaacgg                                                           g
   uacu    uu    ---a       g gu       guaauaacuaaggagucaguuauagacuuaauuguucgauauuuccuauauauauaacg 
Get sequence
Deep sequencing
5507 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr1: 12404208-12404391 [+]
intergenic
Database links

Mature sequence vvi-miR169f

Accession MIMAT0005681
Sequence

13 - 

cagccaaggaugacuugccga

 - 33

Get sequence
Deep sequencing5493 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).