miRBase entry: vvi-MIR169r

Stem-loop vvi-MIR169r


Accession
MI0006532
Description
Vitis vinifera vvi-MIR169r precursor miRNA
Gene family
MIPF0000037; MIR169_2

Literature search
8 open access papers mention vvi-MIR169r
(17 sentences)

Sequence

176 reads, 13 reads per million, 2 experiments
aggguggaauUGAGUCAAGGAUGACUUGCCGauauauauuugcagaaggcaugcaggggcuuuuagcuauguguaaccggcaaguugacuugacucaguuuggcccucu
(((((.(((((((((((((...(((((((((.(((((((..((.((((((........)))))).)).)))))))..)))))))))..))))))))))))).)))))..

Structure
--     g             GAU         -a       uu  a      aug 
  agggu gaauUGAGUCAAG   GACUUGCCG  uauauau  gc gaaggc   c
  ||||| |||||||||||||   |||||||||  |||||||  || ||||||    
  ucccg uuugacucaguuc   uugaacggc  augugua  cg uuuucg   a
uc     g             -ag         ca       -u  a      ggg 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 16415131-16415239 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR169r
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR169r

Accession MIMAT0005687
Description Vitis vinifera vvi-miR169r mature miRNA
Sequence 11 - UGAGUCAAGGAUGACUUGCCG - 31
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558