miRBase entry: vvi-MIR169t

Stem-loop vvi-MIR169t


Accession
MI0006534
Description
Vitis vinifera vvi-MIR169t precursor miRNA
Gene family
MIPF0000037; MIR169_2

Literature search
8 open access papers mention vvi-MIR169t
(15 sentences)

Sequence

123 reads, 9 reads per million, 2 experiments
aggguggaauCGAGUCAAGGAUGACUUGCCGauauauauuugcggaaggacuugcaugggccuuuagcuauguguaaccggcaaguugacuugacucaguuuggcccucu
(((((.((((.((((((((...(((((((((.(((((((..((.(((((.(((....)))))))).)).)))))))..)))))))))..)))))))).)))).)))))..

Structure
--     g    C        GAU         -a       uu  g     a   g 
  agggu gaau GAGUCAAG   GACUUGCCG  uauauau  gc gaagg cuu c
  ||||| |||| ||||||||   |||||||||  |||||||  || ||||| |||  
  ucccg uuug cucaguuc   uugaacggc  augugua  cg uuucc ggg a
uc     g    a        -ag         ca       -u  a     -   u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 16399567-16399676 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR169t
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR169t

Accession MIMAT0005689
Description Vitis vinifera vvi-miR169t mature miRNA
Sequence 11 - CGAGUCAAGGAUGACUUGCCG - 31
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558